1) Though the earliest evolved life forms were anaerobic, there was an eventual predominance of
aerobes on earth. Which of the following is the most
likely reason for it?
a) Evolution of mitochondria and eukaryotic organization.
b) Evolution of photosynthetic organisms.
c) Evolution of heterotrophic organisms.
d) Evolution of terrestrial organisms.
2) Colonization of land by plants was associated with the
evolution of structures to obtain water and to minimize water loss. Which of
the following adaptations are associated with the latter?
i. Development of epidermis with waxy cuticle.
ii. Development of stomata with elaborate opening and
closing mechanism.
iii. Development of bark on old stem and roots.
a) i and ii only
b) i only
c) ii and iii only
d) i, ii and iii
3) Fats and oils are the most preferred reserved foods.
Choose the correct combination of statements given below to support this:
i. They have density lower than most other molecules in a
cell.
ii. Their complete oxidation release energy greater than
other organic polymers.
iii. Being hydrophobic they get clustered and use lesser
space for storage.
iv. Being heteropolymeric they are the most convenient
storage foods.
a) ii & iii b) i
& ii c) i & iv d) iii & iv
4) The secondary structure of proteins mainly owes to the
amino acids that have:
a) sulfhydryl group
b) aromatic group
c) alkaline side chain
d)acidic side chain
5) Which combination of statements correctly relates to
the stress exerted by excess of sodium chloride in the soil on the plants?
i. Salt lowers the water potential of soil.
ii. Salt lowers the pH of soil.
iii. Excess sodium ions exert a toxic influence.
iv. Root hair cells impede the uptake of harmful ions, in
turn reducing the uptake of water.
v. Organic contents of root hair cells make the water
potential less negative than that of
soil.
a) i, iii and v
b) ii, iv and v
c) i, iii, and iv
d) ii, iii, and iv
6) A male English Robin attacks a bundle of red feathers
placed in its territory but ignores a stuffed non red juvenile. This is an
example of:
i)Fixed action
pattern ii) Learned behaviour iii) Learned behaviour
iv) Reflex action
pattern v) Cognitive behavior
a) i only
b) i & ii only
c) i & iv only
d) only iii
7) A few examples of transport across cell membranes are
listed below. Which of them occurs by direct passive diffusion?
a) Movement of oxygen molecules into cells.
b) Movement of sodium ions against its concentration
gradient.
c) Uptake of cholesterol by cells.
d) Secretion of mucus by cells.
8) The interaction between actin and myosin generates the
force for all of the following except:
a) Cytoplasmic streaming in a cell of Chara.
b) Wriggling movement of an earthworm.
c) Closure of leaflets of “touch-me-not” plant.
d) Swallowing of food in man.
9) Which of the cellular organelles mentioned below have
to import all the proteins they contain?
a) Nucleus
b) Lysosomes
c) Chloroplast
d) Mitochondria
10) A few cells and associated entities are listed. Which
of them represents the correct ascending order of the sizes relative to each
other?
a) Mitochondrion <
Paramecium < Human erythrocyte < E. coli
b) Protein < Virus
< Mitochondrion < Paramecium
c) Chloroplast <
protein < human sperm < frog egg
d) Nucleus < protein
< Paramecium < Chloroplast
11) In the accompanying figure, relative concentrations of certain ions in water and in cytosol of the green alga Nitella has been shown. If 5 represents Cl¯, which of the numbered bars in the figure represent Ca+2, Mg+2, Na+ and K+ respectively?
a) 2, 3, 4 & 1
b) 1, 2, 3 & 4
c) 3, 2, 1 & 4
d) 3, 4,1 & 2
12) The chemical transformations occurring in glycolysis
can be summarized as follows:
If NAD+ is not available, the pathway will be blocked at the
reaction represented by:
a) 2
b) 3
c) 4
d) 5
13) In the accompanying diagram a single set of
chromosomes is found in:
i. Germinal cell
ii. Spermatogonium
iii. Primary Spermatocyte
iv. Secondary Spermatocyte
v. Spermatid
a) ii, iii, iv and v
b) i, iii, iv and v
c) Only iv and v
d) Only v
14) Which of the following structures is not found in a
prokaryotic cell
i) Plasma membrane ii) Ribosomes iii) Endoplasmic reticulum
iv) Golgi bodies
a) i and ii
b) ii only
c) iii only
d) iii and iv
15) Which of the following is the key compound in the
intermediary metabolism of carbohydrates, lipids and proteins?
a) PEP
b) PGA
c) Acetyl CoA
d) α-ketoglutarate
16) Denudation of habitats by which of the following
events leads to the fastest secondary succession?
a)Flood b) Fire c) Earthquake d) Volcanic eruption
17) Absence of oxygen will arrest which of the following?
i. EMP Pathway ii. TCA cycle iii. Chemiosmosis coupling iv.
Lactate fermentation
a) i, ii & iii
b) ii, iii & iv
c) Only i & iii
d)Only ii & iii
18) A researcher working with nucleic acids found out
that the cytosine content in a mRNA molecule was 30%. What will be the content
of Adenine?
a)20%
b)30%
c)40%
d)Can’t be deduced
19) A retrovirus with a Reverse transcriptase enzyme
infects a eukaryotic cell and forms a protein whose RNA reads as 5’
AUCGACGAUACGAAAGCCGUACGCUAU 3’. What will be the corresponding sequence in its
original genome?
a) 5’ TAGCTGCTATGCTTTCGGCATGCGATA 3’
b) 5’ AUCGACGAUACGAAAGCCGUACGCUAU 3’
c) 5’ UAGCUGCUAUGCUUUGCCGAUGCGAUA 3’
d) 5’ ATCGACGATACGAAAGCCGTACGCTAT 3’
20) In temperate ponds many short-lived zooplanktonic
species show morphological variations in
successive generations. These are referred to as the
ecotypes of the respective species. They are the reflections of:
a) Directional
mutations
b) Adaptations to physical environment
c) Population
fluctuations
d) Gene flow
21) Which of the following processes are involved in
sympatric speciation?
i. Reduced interactions between populations.
ii. Niche separation
iii. Divergent evolution
iv. Convergent evolution
a) ii & iii only
b) i & iv only c) ii & iv only d) i, ii & iii only
22) The fresh extract of leaves of Bryophyllum dissolves
calcium carbonate. What is the ideal time to collect the leaves to be most
effective?
a) Before daybreak
b) Early hours of day
c) At sunset
d) Late evening
23) When the fruits of a specific plant species were
collected they exhibited a variation in weight. The weight categories were 20,
25, 30, 35 & 40 grams. If it is a polygene inheritance, how many gene loci are
involved?
a) 2 b) 3 c) 4 d) 5
24) The excessive CO2 being released in the atmosphere
through the combustion of fuels is largely
absorbed by seas and oceans thus restricting the green
house effect and global warming. Choose the appropriate combination of the
biological processes that help in minimizing global warming.
i. Photosynthesis by phytoplanktonic species
ii. Deposition of marl and compaction into limestone
iii. Diagenesis of organic sediment into mineral oils
iv. Formation of exoskeleton by marine organisms
a) i, ii & iv
b)i, ii & iii c)Only i & ii d)Only i & iv
25) An alga with cells lacking centrioles, flagella and
having Floridian starch as reserved food has to be a
a) Green alga
b) Blue green alga
c) Red alga
d) Brown algae
Answers:
|
1-b |
2-d |
3-a |
4-a |
5-c |
|
6-a |
7-a |
8-c |
9-b |
10-b |
|
11-d |
12-b |
13- |
14-d |
15-c |
|
16-b |
17-a |
18-d |
19-b |
20-b |
|
21-d |
22-a |
23-a |
24-d |
25-c |