CSIR UGC NET JRF Life Sciences Previous Questions

1. Among the following, which of the following sequence cannot be a part of gene?
a) AGCGCTGCATGGGCCCCC
b) ATTGGCCCTTTTUGCCGCA
c) AAAAATTTTTAAAATTTGGG
d) GCGCGCGAAACCCTTTTAAAA


2. In mammalian females, two X chromosomes are present. Expression of genes on both chromosomes may lead to gene dosage imbalance. This problem is solved by a process called dosage compensation. Dosage compensation is achieved by
csir notes and previous questions
a) hyperactivation of one X-chromosome
b) elimination of one X chromosome
c) hypoactivation of both X chromosomes
d) methylation of one X chromosome


3. Adaptive immunity is mediated by B cells and T cells. T cells interact with other cells through T-cell receptor. B cells lack a typical receptor of its own. B cell receptor is often
a) an IgG molecule
b) an IgM molecule
c) an IgE molecule
d) all of these

4. If bacterial genome and plasmid are allowed to replicate in same manner then
a) bacterial genome will replicate fast
b) plasmid genome will replicate fast
c) both will replicate at the same time
d) depends on GC content

5. On buoyant density gradient centrifugation, a DNA band was observed as high peak corresponding to low density as compare to other DNA. The inference is
a) DNA is GC rich
b) DNA is AT rich
c) [AT]=[GC]
d) single stranded DNA

6. Vibrio cholera causes diarrhea by
a) opening ion channels
b) closing absorption of water from gut epithelium
c) destroys cells of intestinal lining
d) constitutive expression of adenylate cyclase


7. Choose the correct statement regarding the effect of ozone on biosphere
a) Both atmospheric and stratospheric ozone is harmful
b) Both atmospheric and stratospheric ozone is beneficial
c) Atmospheric ozone is harmful but stratospheric ozone is beneficial
d) Atmospheric ozone is beneficial but stratospheric ozone is harmful

8. Split genes are present in
a) all organisms
b) Most of eukaryotes and some eubacteria
c) all eukaryotes
d) Most of eukaryotes and some archaebacteria


9. Many bimolecular are transported from nucleus to cytoplasm through nuclear pores. Which molecule is continuously transported from nucleus to cytoplasm
a) DNA
b) RNA
c) Protein
d) ribosomes

10. Which statement is correct regarding meiosis
a) There is two round of replication and two round of cell division
b) There is one round of replication and one round of cell division
c) There is one round of replication and two round of cell division
d) There is two round of replication and one round of cell division
Learn more:
Answers
1. b) ATTGGCCCTTTTUGCCGCA
2. d) methylation of one X chromosome
3. b) an IgM molecule
4. b) plasmid genome will replicate fast
5. b) DNA is AT rich
6. d) constitutive expression of adenylate cyclase
7. c) Atmospheric ozone is harmful but stratospheric ozone is beneficial
8. d) Most of eukaryotes and some archaebacteria
9. b) RNA
10. c) There is one round of replication and two round of cell division

Post a Comment

We love to hear from you! Leave us a comment.

Previous Post Next Post